|
Database : prokaryotes, Query length : 1192, Number of hits : 16
BLAST query : gi|4758693|ref|NM_004828.1|
(1) EM:AY051399 AY051399 Haemophilus influenzae strain 48P29H1 outer membrane .. S=42.1 E=0.11
(2) EM:AL627279 AL627279 Salmonella enterica serovar Typhi (Salmonella
typhi) .. S=42.1 E=0.11
(3) EM:AF252861 AF252861 Streptococcus pyogenes collagen-like protein Scl gene.. S=40.1 E=0.42
(4) EM:AF173050 AF173050 Orientia tsutsugamushi strain LF-1 56 kDa type-specif.. S=40.1 E=0.42
(5) EM:AE006621 AE006621 Streptococcus pyogenes M1 GAS strain SF370, section 1.. S=40.1 E=0.42
(6) EM:RTU80635 U80635 Rickettsia tsutsugamushi TSA (tsa686) gene, complete cd.. S=40.1 E=0.42
(7) EM:RT19905 U19905 Rickettsia tsutsugamushi TA716 56 kDa type-specific ant.. S=40.1 E=0.42
(8) EM:LMFLA X84699 L.micdadei fla gene S=40.1 E=0.42
(9) EM:AE011159 AE011159 Methanosarcina acetivorans str. C2A, section 504 of 5.. S=38.2 E=1.7
(10) EM:SCJ11 AL109949 Streptomyces coelicolor cosmid J11 S=38.2 E=1.7
(11) EM:AE000714 AE000714 Aquifex aeolicus section 46 of 109 of the complete ge.. S=36.2 E=6.6
(12) EM:AY051408 AY051408 Haemophilus influenzae strain 74P1H1 outer membrane p.. S=36.2 E=6.6
(13) EM:AY051407 AY051407 Haemophilus influenzae strain 74P15H1 outer membrane .. S=36.2 E=6.6
(14) EM:SC6C5 AL034492 Streptomyces coelicolor cosmid 6C5 S=36.2 E=6.6
(15) EM:HIOMPPB M93269 Haemophilus influenzae outer membrane protein P2 (OMPP2.. S=36.2 E=6.6
(16) EM:HIMOMP2N X73389 H.influenzae (A930010) gene for MOMP P2 S=36.2 E=6.6
EM:AL627279 AL627279 Salmonella enterica serovar Typhi (Salmonella typhi)
strain CT18, complete chromosome; segment 15/20
Length = 264050
Score = 42.1 bits (21), Expect = 0.11
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 359 cccactgctactgctgctgctgctg 383
||||||||| |||||||||||||||
Sbjct: 179845 cccactgctgctgctgctgctgctg 179821
©
COPYRIGHT 2005 ALL RIGHTS RESERVED GulfDoctor.net |